I'm making a function that that detect and remove all trailing special characters from string. It can convert strings like :
"hello-world"
"hello-world/"
"hello-world--"
"hello-world/%--+..."
into "hello-world".
anyone knows the trick without writing a lot of codes?
Just for fun
[^a-z\s]+
Regex demo
Explanation:
[^x]: One character that is not x sample
\s: "whitespace character": space, tab, newline, carriage return, vertical tab sample
+: One or more sample
PHP:
$re = "/[^a-z\\s]+/i";
$str = "Hello world\nhello world/\nhello world--\nhellow world/%--+...";
$subst = "";
$result = preg_replace($re, $subst, $str);
try this
$string = preg_replace('/[^A-Za-z0-9\-]/', '', $string); // Removes special chars.
or escape apostraphe from string
preg_replace('/[^A-Za-z0-9\-\']/', '', $string); // escape apostraphe
You could use a regex like this, depending on your definition of "special characters":
function clean_string($input) {
return preg_replace('/\W+$/', '', $input);
}
It replaces any characters that are not a word character (\W) at the end of the string $ with nothing. \W will match [^a-zA-Z0-9_], so anything that is not a letter, digit, or underscore will get replaced. To specify which characters are special chars, use a regex like this, where you put all your special chars within the [] brackets:
function clean_string($input) {
return preg_replace('/[\/%.+-]+$/', '', $input);
}
This one is what you are looking for. :
([^\n\w\d \"]*)$
It removes anything that is not from the alphabet, a number, a space and a new line.
Just call it like this :
preg_replace('/([^\n\w\s]*)$/', '', $string);
Related
my text file is like this:
atagatatagatagtacataacta\n
actatgctgtctgctacgtccgta\n
ctgatagctgctcgctactacgat\n
gtcatgatctgatctacgatcaga\n
I need this file in single string or in single line in both same and reverese order like this:
atagatatagatagtacataactaactatgctgtctgctacgtccgtactgatagctgctcgctactacgatgtcatgatctgatctacgatcaga
and "reverese" (for which I didn't write code because I need help ).
I am using:
<?php
$re = "/[AG]?[AT][AT]GAGG[ATC]GC[GA]?[ATGC]/";
$str = file_get_contents("filename.txt");
trim($str);
preg_match($re, $str, $matches);
print_r($matches);
?>
You can remove spaces and newlines using preg_replace, and you can reverse a string using strrev.
$yourString = "atagatatagatagtacataacta\n actatgctgtctgctacgtccgta\n ctgatagctgctcgctactacgat\n gtcatgatctgatctacgatcaga\n";
$stringWithoutSpaces = preg_replace("/\s+/", "", $yourString);
$stringReversed = strrev($stringWithoutSpaces);
echo $stringReversed;
http://php.net/manual/de/function.preg-replace.php
http://php.net/manual/en/function.strrev.php
Explanation:
With preg_replace you replace any character in $yourString with an empty string "" that matches the search pattern "/\s+/". The \s in the search pattern stands for any whitespace character (tab, linefeed, carriage return, space, formfeed), the + is there to match also multiple whitespace characters, not just one.
I'm trying to remove all words of less than 3 characters from a string, specifically with RegEx.
The following doesn't work because it is looking for double spaces. I suppose I could convert all spaces to double spaces beforehand and then convert them back after, but that doesn't seem very efficient. Any ideas?
$text='an of and then some an ee halved or or whenever';
$text=preg_replace('# [a-z]{1,2} #',' ',' '.$text.' ');
echo trim($text);
Removing the Short Words
You can use this:
$replaced = preg_replace('~\b[a-z]{1,2}\b\~', '', $yourstring);
In the demo, see the substitutions at the bottom.
Explanation
\b is a word boundary that matches a position where one side is a letter, and the other side is not a letter (for instance a space character, or the beginning of the string)
[a-z]{1,2} matches one or two letters
\b another word boundary
Replace with the empty string.
Option 2: Also Remove Trailing Spaces
If you also want to remove the spaces after the words, we can add \s* at the end of the regex:
$replaced = preg_replace('~\b[a-z]{1,2}\b\s*~', '', $yourstring);
Reference
Word Boundaries
You can use the word boundary tag: \b:
Replace: \b[a-z]{1,2}\b with ''
Use this
preg_replace('/(\b.{1,2}\s)/','',$your_string);
As some solutions worked here, they had a problem with my language's "multichar characters", such as "ch". A simple explode and implode worked for me.
$maxWordLength = 3;
$string = "my super string";
$exploded = explode(" ", $string);
foreach($exploded as $key => $word) {
if(mb_strlen($word) < $maxWordLength) unset($exploded[$key]);
}
$string = implode(" ", $exploded);
echo $string;
// outputs "super string"
To me, it seems that this hack works fine with most PHP versions:
$string2 = preg_replace("/~\b[a-zA-Z0-9]{1,2}\b\~/i", "", trim($string1));
Where [a-zA-Z0-9] are the accepted Char/Number range.
I am working with a slug function and I dont fully understand some of it and was looking for some help on explaining.
My first question is about this line in my slug function $string = preg_replace('# +#', '-', $string); Now I understand that this replaces all spaces with a '-'. What I don't understand is what the + sign is in there for which comes after the white space in between the #.
Which leads to my next problem. I want a trim function that will get rid of spaces but only the spaces after they enter the value. For example someone accidentally entered "Arizona " with two spaces after the a and it destroyed the pages linked to Arizona.
So after all my rambling I basically want to figure out how I can use a trim to get rid of accidental spaces but still have the preg_replace insert '-' in between words.
ex.. "Sun City West " = "sun-city-west"
This is my full slug function-
function getSlug($string){
if(isset($string) && $string <> ""){
$string = strtolower($string);
//var_dump($string); echo "<br>";
$string = preg_replace('#[^\w ]+#', '', $string);
//var_dump($string); echo "<br>";
$string = preg_replace('# +#', '-', $string);
}
return $string;
}
You can try this:
function getSlug($string) {
return preg_replace('#\s+#', '-', trim($string));
}
It first trims extra spaces at the beginning and end of the string, and then replaces all the other with the - character.
Here your regex is:
#\s+#
which is:
# = regex delimiter
\s = any space character
+ = match the previous character or group one or more times
# = regex delimiter again
so the regex here means: "match any sequence of one or more whitespace character"
The + means at least one of the preceding character, so it matches one or more spaces. The # signs are one of the ways of marking the start and end of a regular expression's pattern block.
For a trim function, PHP handily provides trim() which removes all leading and trailing whitespace.
I want to change a specific character, only if it's previous and following character is of English characters. In other words, the target character is part of the word and not a start or end character.
For Example...
$string = "I am learn*ing *PHP today*";
I want this string to be converted as following.
$newString = "I am learn'ing *PHP today*";
$string = "I am learn*ing *PHP today*";
$newString = preg_replace('/(\w)\*(\w)/', '$1\'$2', $string);
// $newString = "I am learn'ing *PHP today* "
This will match an asterisk surrounded by word characters (letters, digits, underscores). If you only want to do alphabet characters you can do:
preg_replace('/([a-zA-Z])\*([a-zA-Z])/', '$1\'$2', 'I am learn*ing *PHP today*');
The most concise way would be to use "word boundary" characters in your pattern -- they represent a zero-width position between a "word" character and a "non-word" characters. Since * is a non-word character, the word boundaries require the both neighboring characters to be word characters.
No capture groups, no references.
Code: (Demo)
$string = "I am learn*ing *PHP today*";
echo preg_replace('~\b\*\b~', "'", $string);
Output:
I am learn'ing *PHP today*
To replace only alphabetical characters, you need to use a [a-z] as a character range, and use the i flag to make the regex case-insensitive. Since the character you want to replace is an asterisk, you also need to escape it with a backslash, because an asterisk means "match zero or more times" in a regular expression.
$newstring = preg_replace('/([a-z])\*([a-z])/i', "$1'$2", $string);
To replace all occurances of asteric surrounded by letter....
$string = preg_replace('/(\w)*(\w)/', '$1\'$2', $string);
AND
To replace all occurances of asteric where asteric is start and end character of the word....
$string = preg_replace('/*(\w+)*/','\'$1\'', $string);
I've got text from which I want to remove all characters that ARE NOT the following.
desired_characters =
0123456789!&',-./abcdefghijklmnopqrstuvwxyz\n
The last is a \n (newline) that I do want to keep.
To match all characters except the listed ones, use an inverted character set [^…]:
$chars = "0123456789!&',-./abcdefghijklmnopqrstuvwxyz\n";
$pattern = "/[^".preg_quote($chars, "/")."]/";
Here preg_quote is used to escape certain special characters so that they are interpreted as literal characters.
You could also use character ranges to express the listed characters:
$pattern = "/[^0-9!&',-.\\/a-z\n]/";
In this case it doesn’t matter if the literal - in ,-. is escaped or not. Because ,-. is interpreted as character range from , (0x2C) to . (0x2E) that already contains the - (0x2D) in between.
Then you can remove those characters that are matched with preg_replace:
$output = preg_replace($pattern, "", $str);
$string = 'This is anexample $tring! :)';
$string = preg_replace('/[^0-9!&\',\-.\/a-z\n]/', '', $string);
echo $string; // hisisanexampletring!
^ This is case sensitive, hence the capital T is removed from the string. To allow capital letters as well, $string = preg_replace('/[^0-9!&\',\-.\/A-Za-z\n]/', '', $string)